![]() ![]() Some are Europe-only, and others are just a bit too niche to earn a top spot on the list. While we’ve listed the best Android phones we’ve tested above, there are a few more options out there that might better suit your needs. ![]() It’s cheaper than the Pixel 8, but it still offers a very appealing alternative. Google Pixel 7a: Not everyone can afford to spend more than $800 on a phone, which is where this budget option comes in.It’s ready for one-handed use and doesn’t make any compromises in terms of battery life or performance. ASUS Zenfone 10: If you want a small Android flagship, the Zenfone 10 is the best by far.It folds out into a tablet and supports an S Pen, making it a unique experience in the Android phone world. Samsung Galaxy Z Fold 5: If you have money to burn, the Galaxy Z Fold 5 is the most premium device you can buy.Its pocketable size and attractive design make it a great pick for most people, and after a few iterations of polish, there are now very few tradeoffs for the Flip’s clamshell-style foldable form factor. Samsung Galaxy Z Flip 5: As far as foldables go, the Galaxy Z Flip 5 is the easiest to recommend.Google Pixel 8 Pro: The Pixel 8 Pro is larger and has better cameras than the Pixel 8, with AI capabilities that no other phone can match.ASUS ROG Phone 7: For mobile gamers, the ROG Phone 7 offers everything you could possibly need and then some, including hardware triggers and a robust ecosystem of accessories.Samsung Galaxy S23 Ultra: The true successor to the Note 20 Ultra, the S23 Ultra is the most feature-packed and premium smartphone you can buy outside of foldable.Google Pixel 8: Google has upped its game with the Pixel 8, which still has great cameras and AI smarts, but now with seven years of support baked in.If you’re looking for something a bit more niche, here are our picks for the best of the rest: While we think the Galaxy S23 Plus is the best Android phone for most people, there are plenty of other great options out there.
0 Comments
![]() sourcePath: The file or directory location on sourceMachine.Press Ctrl+Space to view a list of all the remote connections stored in the Connection Manager. targetMachine: The machine to which the file or directory is copied.When building natively on WSL, this option is ignored. sourceMachine: The machine from which the file or directory is copied.By default, only the files necessary for the process to debug get deployed to the remote debug machine. ![]() You only need to configure these settings when you want more granular control over the deployment process.
![]() The question is actually incomplete but lemme tell you how to answer it.Īdenine and Thymine will always be complementaryĬytosine and Guanine will alawys be complementary.ĩ. ![]() the sequence of bases in one dna strand is given below.identify the complementary sequence of bases in the other strand of dna In pairing the complementary base of a DNA the Adenine(A) pairs withhThymine (T) and the Guanine (G) pairs with Cytosine (C).Ĩ. Adenine (A) forms bonds with thymine (T) while cytosine (C) forms bonds with guanine (G) A only ever pairs with T, and C only ever pairs with G. These nucleotides come together to form long chains known as DNA strands. ![]() Write the sequence of bases on a strand of DNA that is complementary to the following DNA strand: CATGCCTAAGCCATĪnswer:These bases are adenine (A), thymine (T), guanine (G) and cytosine (C). During transcription, enzymes called RNA polymerases build RNA molecules that are complementary to a portion of one strand of the DNA double helix (Figure 3).ħ. Transcription is the first step in decoding a cell's genetic information. ![]() During eukaryotic transcription, the molecule that is formed is RNA adenine(A), uracil(U), guanine(G), cytosine(C)Ě = U, G ≡ CĦ. DNA strand AATCGTCCA what the complementary strandĭNA adenine(A), thymine(T), guanine(G), cytosine(C)Ě = T, G ≡ C write the complementary strand of DNA templatesĥ. Each new double strand consists of one parental strand and one new daughter strand.Ĥ. If the strand of dna is replicated the complementary strand isĭuring DNA replication, each of the two strands that make up the double helix serves as a template from which new strands are copied. In DNA replication the rules of complementarity is, A=T and G=CĬomplementary- a section of one nucleic acid chain that is bonded to another by a sequence of base pairs.ģ. DNA replicationDna strand:GGATTAGAC Complementary strand:_DNA strand: CAGAGTATAcomplementary strand:_ Make the complementary DNA strandhelp please, need it asapġ. Use the DNA code provided and fill in the complementary DNA strand.īelow are DNA strands. What Will Be the complementary DNA strand of GAATCT during DNA replication? What is the complementary strand of tye given DNA strand?CGATGATCCATT What is the complementary strand of the given DNA strand Identify the complementary DNA and mRNA base orders for the single DNA strandsĬreate your own strand and its complimentary strandDNA strand :Complementary strand : Given the DNA strand AACTGGTACCATGCTT, give its complementary strand? What is the complementary strand of dna if the first strand is TATCCGĪ strand of DNA has these bases: AGC CAT GTA TAC What is the complementary DNA strand? Use the dna code provided and fill in the complementary DNA strand. If the DNA strand is AATCCGTACGTACGTACGTAC what will be the complementary strand What will be the complementary DNA strand of GAATCT during DNA replication?ĭNA replication the complementary base sequence in the following DNA strand remember in dna strand A. Write the complementary sequence to following DNA strand: Give the DNA complementary nucleotides of the following DNA strand What is the DNA complementary strand of the given parental strand What is the complementary strand of the given dna strand? What is the complementary strand of the given DNA strand CGTAGGCGAACGTTGGCA The sequence of bases in one dna strand is given below.identify the complementary sequence of bases in the other strand of dna Write the sequence of bases on a strand of DNA that is complementary to the following DNA strand: CATGCCTAAGCCAT identical to an entire single strand of DNA double-stranded and inside the nucleus.Ĭ. complementary to part of one strand of DNA.ī. Write the complementary strand of DNA templatesĭNA strand AATCGTCCA what the complementary strandĭuring eukaryotic transcription, the molecule that is formed isĪ. If the strand of dna is replicated the complementary strand is ![]() Should we stay away from numbers that were in the last drawing? But, picking random numbers does increase the odds that if you win, no one else wins. Picking your own numbers doesn’t change the odds of winning. If you pick your favorite number or the day of your birthday like the 7 th, which is the day of the next drawing, many people can be doing the same and that puts a lot of numbers between 1 and 31. But, there are ways that you can make it more probable that you win ALL the money. When the jackpot is this high what should we think about?Īny time you play a lottery like Mega Millions or Powerball, the odds of winning stay the same. The odds are made high enough to make the game compelling and get winners JUST enough that we have hope in the improbable and, frankly, it makes it fun. Second, while someone will win, it simply can take time given how unlikely it is. People frequently pick birthdays and ages, which makes lower numbers more common. But, there is some math behind the growing jackpot.įirst, people can pick numbers–and they tend to pick numbers from a similar range. We will get a winner at some point, which is the exciting part. Why don’t lotteries like Mega Millions and Powerball produce winners more frequently? If you bought 300 tickets, only then would you have the same chances as getting hit by lightning in your lifetime. You are almost 300 times more likely to get hit by lightning in your lifetime than win Mega Millions. You could do this yourself with 28 coins–toss them and see! (Note, you need to select ‘Number’ to be 28.). Here is an app that lets you simulate flipping a coin 28 times. So, the odds are more likely but still very unlikely. You are amazingly unlikely to get it any single time. But, keep in mind, this is like saying you need to flip heads 28 straight times. If you buy five tickets with different numbers, you are five times more likely to win than buying just one. Does buying more tickets increase your odds? The odds that you’ll get it right are incredibly long. One way to visualize it: It’s equivalent to flipping heads on a coin 28 times in a row.Īnother way to think about it: This is akin to my looking back at the past nine years, picking one second, and then asking you to guess which second I chose. How unlikely is it to win a lottery like Mega Millions or Powerball? $768.But according to Math Professor Tim Chartier, there are some small actions that tip those long odds (slightly) in your favor. $1.337 billion, Mega Millions, J(one ticket, from Illinois)Ħ. 23, 2018 (one ticket, from South Carolina)Ĥ. 13, 2016 (three tickets, from California, Florida, Tennessee)ģ. 10 biggest Mega Millions, Powerball jackpots won in U.S. Tickets are sold in 45 states, the District of Columbia, Puerto Rico and the U.S. 'It's ridiculous': Residents in the 5 states without lotteries feel Powerball envy Winners have one year from the date of the winning draw to claim their prize. Retailers that sell winning Powerball tickets receive a bonus of 1 percent of the prize amount. SEE ALSO: Why does the Powerball jackpot get so high? The odds of winning the top Powerball prize are 1 in 292,201,338. Powerball drawings are held every Monday, Wednesday and Saturday. ![]() The Mega Millions jackpot for Tuesday's drawing is now at $480 million, with a cash option of $240.7 million. The Powerball is not the only massive lottery jackpot this week. RELATED: What to consider if you win the lottery The Powerball jackpot is now the eleventh largest lottery jackpot in U.S. The winning numbers for Monday's drawing for a $680 million jackpot were 2, 23, 34, 53, 58 and Powerball 13. The jackpot is now at $725 million for Wednesday's drawing, with a cash option of $366.2 million. The Powerball jackpot is growing again after there was no jackpot winner Monday night. ![]() The Powerball winning numbers lottery drawing did not result in a jackpot winner Monday, with the top prize now growing to $725 million. Besides, we’d make a long list of the issues that the game came with and what frustrated many gamers. If you haven’t had a first-hand experience of Battlefield 5, we will spell out all you need to do about the game. There’s a list of problems that came with the Battlefield 5. Comparing Battlefield 5 to the Battlefield 6 However, from what the producers did for Battlefield 4, we can safely say that there’s a high probability of releasing the current-gen consoles. We are not entirely sure whether the new game will be released on the PS4 or Xbox One. Hence, it’s safe to say that Battlefield 6 PS5 game release is feasible. So, you can expect to see the games on the upcoming consoles. One central question is if the game is compatible with PS5, Xbox Series X, and PC? From the official release of GameSpot, Battlefield 6 will be targeting the innovations by next-gen platforms. Besides, it appears that the window, for now, is from April 2023 to March 2023. All we can do now is cross our fingers and wait for a massive launch of the game. Check out the gameplay trailer for Battlefield 2042's Season 6: Dark Creations to see what's coming, including a new map Redacted, new weapons, new gadgets, a new vehicle, and more. For now, all we know is that the release date for Battlefield 6 is 2023. In recent months, EA DICE has been working on perfecting the game and avoiding any problems. With the Battlefield 6 PC version coming up, we must see if there will be improvements. However, the current Battlefield 5 has intense faults. Generally, Battlefield is on the list of the go-to FPS games that exist today. Brought to you by EA DICE, the game features massive maps, teamwork, and extensive vehicle warfare. It’s a series of first-person shooter video games that started on PC. Hence, we’d see what Battlefield 6 brings to our table.įor gamers that don’t know much about Battlefield, there’s no cause to worry. Features like the notorious 5v5 never made it to the game, and they had severe technical problems. If you are part of the Battlefield community, you should know that some significant features weren’t added to the last version. This time, we hope that the promised features of the Battlefield 6 will make it to the game. ![]() The company is intended to learn from the failure of the previous versions. Photo Credit EAĮA DICE didn’t seem to get it right in Battlefield 5, but this doesn’t mean they wouldn’t come in Battlefield 6. However, can we confidently say that it was a little flop that wouldn’t be passed onto the Battlefield 6? Can we trust the producers of this game with our time and passion for gaming? Well, we’d get to see that and more details in this article. For this reason, many gamers were uninterested in the game. Several things were wrong about the game. You can watch that in the video below.It’s no news that Battlefield 5 was a massive flop. So after all those leaks, what do we actually know as of late May? Well, EA debuted a few brief snippets of footage showing off some visual effects they’re using in Battlefield 6 during last year’s EA Play, including facial rendering, smoke effects, building collapses. It also includes first-person footage of the previously-leaked squad scene, along with a HUD that looks very familiar for Battlefield fans. ![]() The TikTok video appears to have since been taken down, but VG247 reports that footage of the previously seen robot dog appears. Odds are it could simply be internal footage shared at EA and developer DICE, or footage compiled mid-development, before final revisions are made. More video footageĪ TikTok video (first spotted by VG247) previously teased supposed footage of Battlefield 6, but PC Gamer reports that the footage is not from any official trailer, and was never intended to represent the game to the public. These images reinforce the rumor that Battlefield 6 will have a near-future theme, eschewing the previous World War 1 and 2 motifs and returning to something more resembling Battlefield 3 or 4. Unfortunately it looks like no one’s visiting the moon anytime soon, as the rocket is misfired - or maybe struck by enemy fire - and shoots into the adjacent tower. The rocket from the first image can be seen blasting off into the sky, rocket flames burning up the ground beneath. We also see what appears to be a robotic dog, like the infamous Boston Dynamics bots. The album shows off the same island image we saw in the previous leak, plus a number of shots of soldiers being shot at. So it’s a bit difficult to make out what we’re seeing in the images, posted to Imgur. Unfortunately, because the depths of the internet thrive on trolling, they’re all branded with the “lol guy” meme. ![]() Season 6 will be bringing a new map with a dark battleground. More than 50 images, supposedly from a leaked Battlefield 6 trailer, leaked on May 24. Battlefield 2042 has introduced a new first look at Season 6 and the new Redux event coming to the DICE-developed first-person shooter. ![]() In this episode, I build the layout for a log flume attraction featuring multiple drops. WPVI Chopper 6 was overhead as ambulances could be seen near the base of the roller coaster. Welcome back to another episode of building a Six Flags park. Six Flags said all have been treated and released. The DCA said one person suffered a neck injury, two had back injuries and two others were being treated for mouth/tongue injuries. In the updated statement Friday afternoon, Six Flags said it was 13 people total.įive of those evaluated at the park were taken to the hospital for further treatment. In a statement sent to ABC Philadelphia affiliate WPVI on Friday afternoon, Six Flags said the ride completed its normal cycle and all guests exited the ride without need of assistance.Īccording to the DCA, Six Flags said 14 people were treated at the scene. It reads: "If incident results in death, serious injury as defined by code, or failure of a critical structural and/or mechanical component call the hotline."Īccording to the DCA, Six Flags reported witnesses hearing a loud bang and seeing jolting from the El Toro roller coaster as it was in operation. Warner LeRoy's visions for the park wanted everything to be. The ride was planned for the Enchanted Forest and was included in the final design of the theme park when the modified and scaled down designs took shape. The DCA also has an incident report form online available for such cases to be reported. From the earliest concepts of Great Adventure, a log flume style ride was envisioned as being one of the park's main attractions. Officials with the Department of Community Affairs said Six Flags alerted them of the incident Thursday evening through their amusement ride incident hotline number. New Jersey state officials have released more details about a roller coaster incident at Six Flags Great Adventure that injured several people. "Several guests reported back pain after riding El Toro," the amusement park said. JACKSON TWP. ![]() Participants will receive a card to collect stamps for each class they attend. After earning two stamps, participants can turn in their card to be entered to win prizes. Participate in two of three 30-minute intro classes, or attend one equipment demo to enter to win great prizes like a $50 gift card, 20-visit punch card, personal training sessions and massages. ![]() A list of all the free options are below. There are both introductory fitness classes and equipment demos at Buck, Goodson and Lone Tree recreation centers during the week of January 13, 2020. Kickstart your fitness journey with FREE classes at South Suburban recreation centers in January. Denver Airport Parking & Transportation.Anyone have any suggestions for place I could try? I’m on the border of Littleton, Centennial, and Denver and at this point am willing to drive as far as Fort Collins or the Springs to find a kiln for these.Įdited to fix typos. Tucked away, just north of the Streets of SouthGlenn is this neighborhood pool with. Holly: Saturdays June 10, June 24, and July 8. I’ve tried with no success and I’ve called everywhere I can think of except Stone Leaf Pottery (they closed before I could call today). Cook Creek: Saturdays June 10, June 24, and July 15. Enough for around 12 pieces max if I want to 1 design per piece. My local studio (Goodson Rec Center) won’t do it unless I can do a kiln’s worth for them (approximately 80-100 pieces). The overglaze transfers are from Sanbao and require cone 016 for firing. However I’m having trouble finding anywhere in the Denver Metro area in Colorado that will do the low fire needed for the transfers. ![]() However for Christmas, I got some adorable bumble bee overglaze transfers from my mom. Hey y’all! I’m a hobby potter and recently got into underglaze transfers. No concern trolling, gaslighting, misinformation, brigading. Don't editorialize headlines, post duplicate stories, or use non-descriptive titles.Have done parties here at the gymnastics area, tumble tots, pottery classes, golf. Smoky Hill High School Craft Fair, Aurora. Been coming to Goodson with my family for years. Posts should relate specifically to Denver or Colorado. 60+ artisans selling handmade crafts and one-of-a-kind gifts in all price ranges.Buying/Selling/Employment posts will be removed.Don't post about illegal or dangerous activities.No crowdfunding, self-promotion, or spam. About Goodson Recreation Center Goodson Recreation Center is located at 6315 S University Blvd in Centennial, Colorado 80121.No Unofficial Missing Persons, Personal Information, or Lost/Stolen Bike/Car Posts.Please search to see if questions have been asked in the past month, and report any self-posts that have already been posted in the past month and link to that post. Other frequently asked or easily googleable questions may be removed and asked to post in the weekly Q&A thread. Posts about moving or visiting will be removed. Browse 13 goodson recreation center photos and images available, or start a new search to explore more photos and images. The FAQ is also very useful and is regularly updated. Please ask questions related to a move or visit to Denver in the Q&A sticky thread. Useful information, please read if you're new here!ġ. Click here for a list of our weekly meetups! ![]() Explore their menu, locations, and career opportunities online. Explore menu, see photos and read 702 reviews: 'It’s reliable and delicious. cities, including Seattle, Chicago, Memphis. Whether you want to enjoy a happy hour, a family dinner, or a special occasion, Bahama Breeze will make you feel like you are on a tropical island. Book now at Bahama Breeze - Raleigh in Raleigh, NC. Bahama Breeze operates 42 locations, mainly along the East Coast and with 20 in Florida, but a few are scattered across the country in major U.S. This position keeps us running like a well-oiled machine, ensuring that we always maintain the highest safety and sanitation standards throughout our kitchens and dining rooms and have clean and stocked supplies for our culinary and service teams. Caribbean inspired food, handcrafted cocktails, and live music takes you a million miles from home, any day of the week. Bahama Breeze is a Caribbean-inspired restaurant that offers a variety of dishes, drinks and desserts. Most locations are in suburban retail districts and tourist areas. ![]() 7811 Rivers Ave, Charleston, SC 29406 Punta Cana Bar & Grill. As of April 2014, there are 37 Bahama Breeze locations in the United States. 3.6 (167 reviews) Latin American, Seafood, Bars. The Dishwasher is organized, energetic and is the soul of our kitchens. Founded in 1996 by Darden Restaurants, Inc., their first location was in Orlando, Florida on International Drive. For this position, pay will be variable by location - See additional job details and benefits below ![]() The movies initial US release did not announce it as a sequel. Great characters, fantastic action, iconic cars – Mad Max II has it all and deserves its inclusions in greatest movie lists. The Road Warrior (aka Mad Max 2 and Mad Max 2: The Road Warrior) is the 1981 sequel to Mad Max. Then there’s Virginia Hey’s smoking hot Warrior Woman, the righteous leader of the compound, Papagallo, with his twin 351-engined buggy, and the Feral Kid with his lethal boomerang and limited vocabulary. Mad Max 2 (also known as The Road Warrior in the U.S., and Mad Max 2: The Road Warrior) is a 1981 Australian apocalyptic and post-apocalyptic action film. Mad Max 2 (1981) Movie Poster High Quality Glossy Paper A1 A2 A3 A4 A3 Framed or Unframed. ![]() Actor: Mel Gibson, Bruce Spence, Michael Preston. He agrees to help a community of survivors are living in an oil refinery in order to protect them and the supply of gas from the barbarian warrior. The genius of this film is George Miller’s vision of a post-apocalyptic dystopia, not to mention a brilliant cast of characters, from The Humungous and Wez to the Gyrocopter Pilot and the paraplegic mechanic, who gets one of the film’s most memorable lines: “Last of the V8 Interceptors – a piece of history. The film revolves around a former Australian policeman. The original XB from Mad Max was modified and is featured in the close-up and interior shots in this film, while a replica was made for the chase scenes and was blown up as part of the movie. There are a bunch of classic cars among the 80 used in the film, and the keen of eye will spot a pink 1959 Desoto, a couple of Valiant Chargers, a Monaro with a front end that looks more at home on a Willys, a ZG Fairlane, a Landau, a couple of F100s, a VF Valiant, an XA coupe, a chopped up HQ Statesman and a Customline. The cynical drifter Max sets out into the wastelands of Australia in search of fuel and food. But a shot of NOS, and a chrome exhaust stack, brings about the tragic demise of that wonderful XB. The Road Warrior (1981) Mad Max 2/ Mad Max 2: The Road Warrior. The rest of the film is about how Max tries to outsmart the gang, so he can get in and out of the compound with full tanks of gas. ![]() 'The Great British Baking Show' Bakers Are Being Sabotaged By This Surprise Villain in the Tent "I’ve Lost All Faith": Does Paul Hollywood Speak for All 'Great British Baking Show' Fans After "Dessert Week"? New Shows & Movies To Watch This Weekend: Netflix's 'The Killer' + More Love Is Dead: 'The Gilded Age' EP Explains Why Even Perfect Couple, George and Bertha Russell, Have Problems 'The Gilded Age' Star Kelley Curran Says There’s a "Strange Intimacy" Between Turner and Carrie Coon’s Bertha Russell: "The History is Deep" 'The Gilded Age' Season 2 Episode 3 Recap: Wilde'n Out 'The Golden Bachelor's Faith Martin Speaks Out After Emotional Elimination: "It Shattered Me" 'The Golden Bachelor' "Women Tell All" Recap: Who Went Home? Faith Or Theresa? Natascha's Chair Earrings Were The Real Stars Of 'The Golden Bachelor's "Women Tell All" ![]() 'The Golden Bachelor' Snubs Matt James' Mom Patty Again On "Women Tell All" Episode Stream It Or Skip It: ‘Ruby Gillman, Teenage Kraken’ on Peacock, an Animated Adventure That's Generic In Spite of That Title Stream It Or Skip It: ‘Peter and the Wolf’ on Max, an Animated Short that Reinvigorates a Familiar Tale 'The Nightmare Before Christmas' Turns 30: Tim Burton and Henry Selick's Vision Has Become A Definitive Halloween ClassicĪn Ode To Ursula, One Of The Most Iconic Witches To Ever Do It ‘Psy Summer Swag 2022’ Sees K-Pop Superstar's Thrilling Return To The Stage Stream It Or Skip It: ‘Robbie Williams’ on Netflix, An Autobiographical Docuseries With The Superstar English Singer In A Meditative Mood Stream It Or Skip It: ‘BTS: Yet To Come’ on Prime Video, Capturing The K-Pop Superstars’ Final Concert Before A Turn Of The Career Page Q: Is The "New" Beatles Song "Now And Then" A Moving Homage Or AI-Generated Cash Grab? A: Yes Hannah Waddingham Admits To 'The View' She Still Knows "Nothing" About Soccer After Starring In 'Ted Lasso': "Greatest Acting Job"ĭrew Barrymore and Hilary Duff Look Back At Their Fashion Hits And Flops In Game "Y2K Yay Or Nay" On 'The Drew Barrymore Show': "Who Did That To Me?" James Gordon Meek's Child Pornography Conviction Results In Hulu's '3212 Un-Redacted' Documentary Being Pulled From Service Stream It Or Skip It: 'Albert Brooks: Defending My Life' on Max, an Intimate Retrospective on a Singular Comedy Artist ![]() Kevin Turen: 'Euphoria' and 'The Idol' Producer Dead At 44 'Tiny Pretty Things' Star Barton Cowperthwaite Reveals He's Been Diagnosed With A Brain Tumor ‘Napoleon’ Review: Ridley Scott’s Farcical Epic Turns Joaquin Phoenix’s Titular Tyrant Into A Foolish Loserīarbra Streisand Dishes on Steamy Past with 'A Star Is Born' Co-Star Kris Kristofferson: "He Gave Me Hickeys on my Neck" Stream It Or Skip It: 'BlackBerry' On AMC, A Comedic Look At The Rise And Fall Of The Smartphone Pioneerīowen Yang Mistakes ‘SNL’ Comedians Please Don’t Destroy For “Three Gorgeous Girls’ in Exclusive ‘Foggy Mountain’ Clip 'Ted Lasso' Co-Stars Jason Sudeikis And Hannah Waddingham Reunite For A Powerful Duet Of "Shallow" Jason Alexander Reacts to Possible 'Seinfeld' Reboot: "No One Called Me" The 23 Best Horror Movies Of The 21st Century (So Far) Streamin' King: 'The Boogeyman' Expands A Short Story Into A Full-Length Monster Movie Stream It Or Skip It: ‘Insidious: The Red Door’ on Netflix, The Fifth Outing In The Horror Franchise That Continues To Deliverĭecider's Scary Movie Challenge For Scaredy-Cats: 7 Horror Films Ranked From Goofy Ghosts To Full-On Gore Fest |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |